Nano-biosensing for Healthcare

With the achievements of nanotechnology, biosensing starts to take advantage of a wide variety of nanoscale materials and phenomena. Nanobiosensing opens up novel concepts in basic research and new tools for ultrasensitive biodetection in clinical and industrial applications. Extremely low detection limits, even reaching the single biomolecule level, have been demonstrated. Nanobiosensors not only enhance the detection capabilities, but also promise rapid, inexpensive, portable and label-free tools.

In our group, nanobiosensing activities are based on three main approaches:

 

Nanomechanical biosensors

The main goal of this research activity is to develop an innovative analytical system based on microcantilever resonators (MCs), able to supplant traditional expensive and time-consuming protocols.

MCs are fabricated in Chilab - Materials and Microsystems Laboratory exploiting surface and bulk micromachining techniques. Each sensor array is composed by 11 microcantilevers 460–600 μm long, 50–70 μm wide, 5–10 μm thick. These sensors act as microbalances weighting target molecule mass with sensitivity in the picogram range. The MC silicon surface is activated by a biochemical functionalization that allows a strong binding with antibodies. The probes capture the target molecules increasing the mass of the microbeams and leading to a negative shift in resonance frequency. Measurements are carried out before and after the binding event, in vacuum conditions at a controlled temperature, using two characterizing systems, manual or semiautomatic one (CantiRed, Microla Optoelectronics s.r.l.). Cantilevers are excited at different frequencies by a piezoelectric crystal connected to a function generator, while a laser diode is focussed on the apex of the cantilever and reflected onto a Position Sensitive Detector (optical lever technique).

 

 

 

 

 

 

Cantilever array (SEM image)

 

A labview program manages the resonant frequency acquisition process and the resonance value derives from a fitting function of the resonance peak based on the Lorentzian curve equation.

Cantired reading system and cantilever array positioning into measurement chamber

 

The shift in resonance frequency is proportional to the mass added to the sensor: the quantification of the target molecules can be achieved without use of labels, reducing assay times, reagent and sample volumes thanks to miniaturization of the device.

In the last years, research efforts were focused on detection of cancer marker in blood (Angiopoietin-1), growth promoting agent (17-β-estradiol), toxic and carcinogenic contaminants (mycotoxins) and pathogenic bacteria (Salmonella spp.). Results are promising and microcantilever biosensors show advantages respect to traditional analysis, in particular when compared to ELISA analysis (Enzyme-Linked Immunosorbent Assay). They are label-free sensors and the sensitivity is higher than commercial ELISA tests.

The applicability of microcantilever-based system for cancer diagnostic had been demonstrated; MCs can detect Angiopoietin-1 masses of the order of few hundreds of picograms with less than 0.5% of relative uncertainty. Thanks to its fine precision and optimal specificity, microcantilever sensors can be successfully applied as a quantitative tool for systems biology studies such as the comprehension of angiogenic machinery and cancer progression.

Further application of microcantilever biosensors are detailed in section Food Safety Diagnostics.

 

Staff

Gianluca Palmara: PhD student

Alessandro Chiadò, Simone L. Marasso, Stefano Stassi: Post-Doc

 

Contact information

Carlo Ricciardi

Tel. +39 011 090 7398

carlo.ricciardi@polito.it

 

Publications

  1. “Development of a microcantilever-based immunosensing method for mycotoxin detection”, C. Ricciardi, R. Castagna, I. Ferrante, F. Frascella, S.L. Marasso, A. Ricci, G. Canavese, A. Lorè, A. Prelle, M.L. Gullino, D. Spadaro. Biosensors and Bioelectronics 40 (2013) 233–239.
  2. “Immunodetection of 17β-estradiol in serum at ppt level by microcantilever resonators”,C. Ricciardi, I. Ferrante, R. Castagna, F. Frascella, S.L. Marasso, K. Santoro, M. Gili, D. Pitardi, M. Pezzolato, E. Bozzetta. Biosensors and Bioelectronics 40 (2013) 407–411.
  3. “Functionalization protocols of silicon micro/nano-mechanical biosensors”, F. Frascella, C. Ricciardi. Nanomaterial Interfaces in Biology Nanomaterial Interfaces in Biology. Springer (2013) pp. 109-115.
  4. “Microcantilver-based DNA hybridization sensors for Salmonella identification”, R. Patti, M.T. Bottero, A. Dalmasso, A. Grassi, I. Ferrante, K. Santoro, N. Ciprianetti, C. Ricciardi. Italian Journal of Food Safety Vol. 1 (2012) 17-19, ISSN: 2239-7132.
  5. “Online Portable Microcantilever Biosensors for Salmonella enterica Serotype Enteritidis Detection” C. Ricciardi, G. Canavese, R. Castagna, G. Digregorio, I. Ferrante, S.L. Marasso, A. Ricci, V. Alessandria, K. Rantsiou,  L.S. Cocolin. Food Bioprocess Technol 3 (2010) 956–960.
  6. Development of microcantilever-based biosensor array to detect Angiopoietin-1, a marker of tumor angiogenesis”, C. Ricciardi, S. Fiorilli, S. Bianco, G. Canavese, R. Castagna, I. Ferrante, G. Digregorio, S.L. Marasso, L. Napione, and F. Bussolino. Biosensors and Bioelectronics, 25 (2010) 1193-1198.
  7. “ Integration of microfluidic and cantilever technology for biosensing application in liquid environment” C. Ricciardi, G. Canavese, R. Castagna, I. Ferrante, A. Ricci, S. L. Marasso, L. Napione, F. Bussolino, Biosens. Bioelect., 26 (2010) 1565-1570

 

 

Biosensors based on Bloch Surface Waves sustained on photonic crystals

The aim of this research activity is to exploit Electromagnetic Bloch Surface Waves (BSWs) coupled to dielectric multilayers as a peculiar optical transduction method applied for biosensing.

During the last years, many different fields of research like biology, biochemistry and pharmaceutics run in parallel with the need of employing new optical sensing techniques that allow the detection of small quantities of analyte in a liquid or gaseous samples. Surface plasmon resonance (SPR) sensing is an optical label-free technique that can be easily used for this purpose: it shows high sensitivity, good reproducibility and selectivity, and commercial SPR platforms are now available. SPR and plasmon-related techniques rely essentially on the exploitation of electromagnetic fields strongly confined on the surface of metallic films. In alternative to Surface Plasmon Polariton waves, surface modes on photonic crystals can be used. As an example, periodic multilayered structures (or one-dimensional photonic crystals, 1DPC) represent a promising platform for implementing sensing schemes based on the coupling of BSWs. Although photonic structures with higher dimensionalities can be used to sustain surface modes, the BSWs we are considering can be either TE- or TM –polarized electromagnetic waves propagating at the surface of properly designed dielectric 1DPC.

Recently, we used BSW on 1DPCs for demonstrating label-free detection schemes based on spectral/angular resonance shift, or to improve fluorescence-based detection. The structure is tailored with a polymeric layer providing a chemical functionality facilitating the covalent binding of orienting proteins needed for a subsequent grafting of antibodies in an immunoassay detection scheme.

Sketch of a typical photonic structure and the experimental configuration for BSW controlled fluorescence

Real-time sensorgram (shift of the fluorescence peak generated by a PPAA layer impregnated with an ethanolic solution of Cy3 dye) showing the covalent binding of protein G onto the functional polymeric film during incubation in PBS buffer

 

Staff

Angelo Angelini, Valeria Moi, Riccardo Rizzo: PhD students

Serena Ricciardi, Francesca Frascella, Andrea Lamberti: Post-Doc

Emiliano Descrovi, Fabrizio Giorgis, Paola Rivolo, Pietro Mandracci: Researchers

 

Contact information

Emiliano Descrovi

Tel. +39 011 090 7354

emiliano.descrovi@polito.it

 

Publications

  1. “Bloch surface wave-enhanced fluorescence biosensor”, Koji Toma, Emiliano Descrovi, Mana Toma, Mirko Ballarini, Pietro Mandracci, Fabrizio Giorgis, Anca Mateescu, Ulrich Jonas, Wolfgang Knoll, Jakub Dostálek. Biosensors and Bioelectronics 43 (2013) 108–114.
  2. “A Fluorescent One-Dimensional Photonic Crystal for Label-Free Biosensing Based on Bloch Surface Waves”, F.Frascella, S. Ricciardi, P. Rivolo, V. Moi, F. Giorgis, E. Descrovi, F. Michelotti, P. Munzert, N. Danz, L. Napione, M. Alvaro, F. Bussolino. Sensors 13 (2013) 2011–2022.
  3. “Real-time Amyloid Aggregation Monitoring with a Photonic Crystal-based Approach”, S. Santi, V. Musi, E. Descrovi, V. Paeder, J. Di Francesco, L. Hvozdara, P. Van Der Wal, H.A. Lashuel, A. Pastore, R. Neier, H.P. Herzig. Chem. Phys. Chem. 14 (2013) 3476-3482.
  4. “Direct comparison of the performance of Bloch surface wave and surface plasmon polariton sensors”, A. Sinibaldi, N. Danz, E. Descrovi, P. Munzert, U. Schulz, F. Sonntag, L. Dominici, F. Michelotti. Sensors and Actuators B, Chemical 174 (2012) 292-298.
  5. “Hydrogenated amorphous silicon nitride photonic crystals for improved-performance surface electromagnetic wave biosensors”, A. Sinibaldi, E. Descrovi, F. Giorgis, L. Dominici, M. Ballarini, P. Mandracci, N. Danz, F. Michelotti. Biomedical Optics Express 3 (2012) 2405-2410.
  6. “Real time secondary antibody detection by means of silicon-based multilayers sustaining Bloch Surface Waves”, P. Rivolo, F. Michelotti, F. Frascella, G. Digregorio, P. Mandracci, L. Dominici, F. Giorgis, E. Descrovi. Sensors and Actuators B, Chemical 161 (2012) 1046-1052.
  7. “Surface label-free sensing by means of a fluorescent multilayered photonic structure”, E. Descrovi, F. Frascella, M. Ballarini, V. Moi, A. Lamberti, F. Michelotti, F. Giorgis, C.F. Pirri. Applied Physics Letters 101 (2012) 131105.
  8. “Temperature stability of Bloch surface wave biosensors”, E. Descrovi, F. Michelotti. Applied Physics Letters 99 (2011) 231107.
  9. “Experimental determination of the sensitivity of Bloch surface wave based sensors”, F. Giorgis, E. Descrovi, C. Summonte, L. Dominici, F. Michelotti. Optics Express 18 (2010) 8087-8093.

 

 

Plasmonic nanostructures for SERS biodetection

Surface Enhanced Raman Scattering (SERS) is a sensitive technique allowing vibrational spectra from individual molecules to be measured. Among single-molecule spectroscopies, it provides much more detailed information as compared to the broad fluorescence spectra. Actually, due to the almost unstructured spectra, fluorescence does not provide detailed molecular information, and photobleaching effects often inhibit single molecule analysis. Raman spectroscopy provides highly resolved vibrational information and although the molecular Raman cross sections are much smaller than the fluorescence ones, the SERS mechanism can enhance the Raman efficiency making it competitive in terms of signal intensity.

In the framework of this research activity, metal-dielectric nanostructures consisting of Ag nanoparticles are synthesized within a mesoporous silicon matrix (Ag/pSi) on large area by dip coating and ink-jet printing. These substrates are exploited for detection of biological assays approaching single molecule detection by surface-enhanced resonance Raman scattering (SERRS). The nanostructures morphology is controlled yielding plasmonic resonances in the visible-near-infrared range. Tuning the particle plasmonic resonance close to the molecule electronic resonance, we have demonstrated Raman enhancements larger than 10^10.

As representative examples, these efficient SERS-active substrates were successfully used for the detection of short peptides and miRNA, consisting of small non-coding single-stranded sequences that are of great relevance in gene regulation affecting process such as cell proliferation, cell death and oncogenesis. The recognized roles of these sequences suggest that some miRNA or pattern of miRNA can be used as biomarker for early cancer diagnosis. In particular, we optimized a protocol for the thiolated cDNA oligonucletides immobilization on the silver nanoparticles. The successful binding of -SH terminated cDNA on Ag nanoparticles  was checked by SERS measurements and confirmed by ELISA analysis performed on flat Ag silicon substrates functionalized with the same protocols. Promising results were observed in tests concerning with cDNA-miRNA hybridization using blocking agents/spacers in a cDNA co-immobilization protocol. The Raman fingerprint of the cDNA-miRNA complex showed selectivity and reproducibility as required by most of the SERS applications on biological assays.

 

SERS spectra of the CSFNIT peptide chemisorbed on functionalized Ag/pSi, compared with the Raman spectra of the pure amino acids constituting the sequence.

 

 

 

SERS spectra concerning with the detection of cDNA-miRNA (5’[Cy5]AGCUACAUCUGGCUACUGGGU3’) hybridization on Ag/pSi

Staff

Chiara Novara, Angelo Angelini: PhD students

Alessandro Virga, Andrea Lamberti, Alessandro Chiadò, Serena Ricciardi, Francesca Frascella: Post-Doc

Fabrizio Giorgis, Emiliano Descrovi, Paola Rivolo: Researchers

 

Contact information

Fabrizio Giorgis

Tel. +39 011 090 7354

Fabrizio.giorgis@polito.it

 

Publications

  1. “Silver Nanoparticles on Porous Silicon: Approaching Single Molecule Detection in Resonant SERS Regime”, Alessandro Virga, Paola Rivolo, Francesca Frascella, Angelo Angelini, Emiliano Descrovi, Francesco Geobaldo, Fabrizio Giorgis. Journal of Physical Chemistry C 117 (2013) 20139-20145.
  2. “Ag/pSi SERS platforms as biosensors for oligonucleotides/miRNA detection”, A.Virga, A. Chiadò, S. Ricciardi, F. Frascella, C. Novara, P. Rivolo, F. Geobaldo, F. Giorgis. Porous Semiconductors - Science and Technology– PSST2014 Proceedings p. 224.
  3. “SERS active Ag nanoparticles in mesoporous silicon: detection of organic molecules and peptide-antibody assays”, A. Virga, P. Rivolo, E. Descrovi, A. Chiolerio, G. Digregorio, F. Frascella, M. Soster, F. Bussolino, S. Marchiò, F. Geobaldo, F. Giorgis. Journal of Raman Spectroscopy 43 (2012) 730-736.
  4. “Direct patterning of silver particles on porous silicon by inkjet printing of a silver salt via in-situ reduction”, A. Chiolerio, A. Virga, P. Pandolfi, P. Martino, P. Rivolo, F. Geobaldo, F. Giorgis. Nanoscale Research Letters 7 (2012) 502-507.
  5. “Metal-dielectric nanostructures for amplified Raman and fluorescence spectroscopy”, Alessandro Virga, Rossana Gazia, Luca Pallavidino, Pietro Mandracci, Emiliano Descrovi, Angelica Chiodoni, Francesco Geobaldo, Fabrizio Giorgis. Physica Status Solidi C 7 (2010) 1196-1199.
  6. “Porous Silicon as efficient Surface-Enhanced Raman Scattering (SERS) Substrate”, F. Giorgis, E. Descrovi, A. Chiodoni, E. Froner, M. Scarpa, A. Venturello, F. Geobaldo. Applied Surface Science 254 (2008) 7494-7497.